Home About us Current issue Ahead of Print Back issues Submission Instructions Advertise Contact Login   

Search Article 
  
Advanced search 
 
Saudi Journal of Kidney Diseases and Transplantation
Users online: 695 Home Bookmark this page Print this page Email this page Small font sizeDefault font size Increase font size 
 

Table of Contents   
ORIGINAL ARTICLE  
Year : 2021  |  Volume : 32  |  Issue : 6  |  Page : 1615-1627
Clinicopathological Impact of Gene Polymorphism of Nephrin and Glucocorticoid Receptor Genes in Egyptian Children with Nonfamilial Nephrotic Syndrome


1 Pediatric Nephrology Unit, Mansoura University Children’s Hospital, Mansoura University, Mansoura, Egypt
2 Department of Medical Biochemistry, Mansoura University, Mansoura, Egypt
3 Pediatric Genetics Unit, Mansoura University Children’s Hospital, Mansoura University, Mansoura, Egypt

Click here for correspondence address and email

Date of Web Publication27-Jul-2022
 

   Abstract 


Idiopathic nephrotic syndrome (NS) is one of the most common primary glomerular diseases in children. In this study, we investigate the association of single-nucleotide polymorphisms of nephrin gene and glucocorticoid receptor gene (NR3C1) and susceptibility to develop NS and the response to steroid therapy in 100 Egyptian children with NS using polymerase chain reaction-restriction fragment length polymorphism. We also analyzed the correlation between the genotypes and clinicopathologic features of the patients. Thirty-four patients (34%) were initial steroid nonresponders, renal biopsy findings of those patients were available, of which 22 (64.7%) showed minimal change NS and 12 (35.3%) had focal segmental glomerulosclerosis. The distribution of the genotypes was comparable between the patient and control groups, allele frequencies showed no significant difference between the patient’s group and the control group. The genotypes showed no correlation with the age of onset of NS, initial steroid responsiveness, renal pathologic findings, estimated glomerular filtration rate (eGFR), and serum albumin. However, 24-h protein in urine showed a significant association with the NR3C1 gene. These data suggested that the nephrin gene and NR3C1 gene SNPs do not affect the development of NS, initial steroid responsiveness, renal pathological lesion, eGFR, and serum albumin. However, 24-h protein in urine showed a significant association with the NR3C1 gene in Egyptian children with NS.

How to cite this article:
El-Refaey AM, Elsamanoudy AZ, Elmorsy Z, Gaber E, Sarhan A, Hammad A, Zedan MM, Bakr A. Clinicopathological Impact of Gene Polymorphism of Nephrin and Glucocorticoid Receptor Genes in Egyptian Children with Nonfamilial Nephrotic Syndrome. Saudi J Kidney Dis Transpl 2021;32:1615-27

How to cite this URL:
El-Refaey AM, Elsamanoudy AZ, Elmorsy Z, Gaber E, Sarhan A, Hammad A, Zedan MM, Bakr A. Clinicopathological Impact of Gene Polymorphism of Nephrin and Glucocorticoid Receptor Genes in Egyptian Children with Nonfamilial Nephrotic Syndrome. Saudi J Kidney Dis Transpl [serial online] 2021 [cited 2022 Aug 14];32:1615-27. Available from: https://www.sjkdt.org/text.asp?2021/32/6/1615/352422

   Introduction Top


Idiopathic nephrotic syndrome (NS) is the prevailing glomerular disease in children.[1] NS is defined as heavy proteinuria (>40 mg/m2/h collection of urine), accompanied by hypo-albuminemia (≤2.5 g/dL) or by a spot urinary protein-to-creatinine ratio higher than 0.25 g protein/mmol creatinine (or >2.0 mg protein/ mg creatinine).[2] The annual incidence of between 2.0 and 2.7 cases/100,000 children in the USA and a cumulative prevalence of 16 per 100,000.[3] NS can be clinically classified as steroid-sensitive NS (SSNS) and steroid-resistant NS (SRNS) forms according to the responsiveness to oral glucocorticoid treatment, which is the first line of drug for childhood idiopathic NS.[4]

The recent discovery of genes involved in idiopathic NS represents a milestone in nephrology.[1] Several genes have been involved in the development of NS and contributed to the understanding of the pathophysiology of glomerular proteinuria.[5] At present, seven genes which mutations are responsible for severe forms of NS are known: NPHS1, ACTN4, NPHS2, CD2AP, WT1, TRPC6, and LAMB2. Proteins encoded by these genes (nephrin, “-actinin-4, podocin, and others) influence the function of the podocytes.[6]

The most common genetic variations in the human genome are single-nucleotide polymorphisms (SNPs). These are sites in the DNA sequence where individuals differ at a single DNA base at a frequency of more than 1% of the population. Testing numerous individual SNPs along a candidate gene is a tedious and expensive process. On the other hand, haplotype analysis which takes into account multiple SNPs simultaneously could serve the same purpose with little loss of statistical power.[7]

These SNPs may be selected according to the observation that some appear to be located in “blocks” which are regions with little historical recombination but demarcated by areas with an inferred high frequency of recombination events. A reduced set of tagging SNPs can then be identified and genotyped.[8]

This current study aimed to investigate SNPs of the NR3C1 gene (BclI) and nephrin gene (rs#466452) in a group of pediatric patients with NS and to analyze the correlation between these genotypes and the clinicopathological features of those patients.


   Materials and Methods Top


Patients

This study was conducted at the Mansoura University Children’s Hospital, Nephrology Unit, which is located in northern Egypt and which provides service for an estimated population of about 20 million people, 60% of them children.[9]

A case-control study was carried out on 100 Egyptian children patients with idiopathic NS in relation to age- and gender-matched 100 controls during the period from January 2013 to January 2014. Patients were selected from the inpatient and outpatient nephrology clinic, Mansoura University Children’s Hospital. Patients and controls were studied after informed consent had been obtained with methods approved by the Ethics Committees of Faculty of Medicine, Mansoura University.

We included in this study patients who fulfilled the criteria of the International Study for Kidney Disease in Childhood for the diagnosis of NS.[10]

The following patients were excluded from the study: patients with onset of disease during the 1st year of life (for exclusion of congenital and infantile NS), those with reflux nephropathy, renal hypoplasia, family history of glomerulonephritis, and focal sclerosis secondary to membranoproliferative glomerulonephritis, and those with systemic disease such as systemic lupus erythematosus and IgA nephropathy.

Blood pressure was measured according to the recommendations of the last update on the Second Task Force of the American Academy of Pediatrics.[11] The estimated glomerular filtration rate (eGFR) was calculated and normalized for the body surface area using the Schwartz formula.[12] Renal biopsy was performed after informed consent for 34 patients who showed steroid resistance. Informed consent for the genetic analysis was obtained from all patients and/or their parents.

The definitions that were used in the study were as follows:

1. Complete remission: Absence of proteinuria by urine dipstick examination for three consecutive days or urine protein-to-creatinine ratio of <0.2

2. Partial remission: Decrease in urine protein-to-creatinine ratio by ≥50% from the baseline on initial presentation steroid resistance: No improvement in proteinuria after one month of prednisone therapy of 60 mg m-2 day-1 divided BID, maximum of 40 mg BID

3. Steroid dependence: Relapse while on alternate-day steroid therapy or within 28 days of stopping steroid therapy.[13]

Biochemical investigation

All subjects were instructed to fast for at least 12 h. A blood sample was withdrawn. Three milliliters was delivered to centrifuge tubes containing K2EDTA (stored as EDTA-anticoagulated blood sample at -30°C for DNA extraction). Another 5 mL of blood sample was allowed to clot for 15 min and centrifuged at 7000 rpm for 10 min for serum separation to determine serum creatinine, albumin, cholesterol, triglycerides, and complement 3 concentration.

DNA extraction: Genomic DNA was extracted from EDTA-anticoagulated peripheral blood leukocytes using a QIAamp DNA Blood Mini Kit supplied by Qiagen GmbH (Cat, No. 51104, Hilden, Germany).

The average DNA concentration (0.127 ±005 μg/μL) was determined from the absorbance at 260 nm (Jenway, Genova Model, UK). All samples had a 260/280 nm absorbance ratio between 1.6 and 1.79. The integrity of the DNA was checked by electrophoresis on 0.8% agarose gel stained with ethidiumbromide.

Genotyping of single-nucleotide polymorphism rs#466452 of the nephrin gene

Polymerase chain reaction (PCR): Conventional method of PCR amplification was used for genotyping of rs#466452 of the nephrin gene SNP by the method described by González et al.[14] The primer sequences used for DNA amplification are as follows: F 5’- ACAGCCTGTTGTC TGGGATTCACT-3’. 5’ -GACCTTCAGTATGCAGCAACCACA-3 ’. PCR was carried out in 50 pL final reaction volume using ReadyMix (RED-Taq PCR Reaction Mix) (purchased from Sigma Aldrich, Saint Louis, USA). The following mixture was prepared for each sample: 25 μL RED-Taq PCR reaction Mix (1X), 1 μL: (20 pmol) of forwarding primer, 1 μL (20 pmol) of reverse primer, 2 μL (200 ng) of genomic DNA, and 21 μL of double-distilled deionized water. This mix was put in a thin-wall PCR microcentrifuge tube and gently centrifuged to collect all components to the bottom of the tube. Then, 50 μL of mineral oil was added to prevent evaporation. Amplification was performed in a Thermal Cycler (TECHEN TC- 312, Model FTC3102D, Barloworld Scientific Ltd., Stone, Staffordshire, st 150 SA, UK) using the following program: initial 5-min denaturation at 94°C followed by 30 cycles of denaturation at 94°C for 60 s, annealing at 60°C for 60 s, extension at 72°C for 60 s, and a final extension for 10 min at 72°C. The resulting PCR product was 244 bp in length. The PCR products were digested using Ava I (NewEnglandBiolabs-Catalog # R0152S). The products were subjected to agarose gel electrophoresis using 2% agarose stained with ethidium bromide and visualized via Light UV Transilluminator (Model TUV-20,OWI Scientific, Inc. 800 242-5560) and photographed [Figure 1].
Figure 1. Agarose gel electrophoretic analysis single-nucleotide polymorphism rs#466452 of the nephrin gene: Lane 1 represents the molecular marker (DNA molecular weight marker, purchased from promega Tecnical Service, Catalog #G3161). Lane 2 represents the product of PCR amplification of the gene that is presented by one band at 244 bp. Lane 3 represents the T/T genotype is presented showing two bands at 193 and 51 bp. Lane 4 represents the C/C genotype showing two bands at 149 and 51 bp. Lane 5 represents the C/T genotype showing three bands 193, 149, and 51bp. Lane 6 represents negative control. Band at 51bp is not clearly seen.

Click here to view


Genotyping of single-nucleotide polymorphism of glucocorticoid receptor gene (NR3C1 –nuclear receptor subfamily 3, group C, member 1) BclI-polymorphism (rs 41423247)

PCR: Conventional method of PCR amplification was used for genotyping of rs#466452 of the glucocorticoid receptor (GR) gene SNP by the method described by Kostik et al.[15] The primer sequences used for DNA amplification are as follows: F5’-’ AAATTGAAGCTTAACAATTTTGGC-3’5’ - GCAGTGAACAGTGTACCAGACC 3’. PCR was carried out in 50 μL final reaction volume Using ReadyMix (REDTaq-PCR Reaction Mix) (purchased from Sigma Aldrich, Saint Louis, USA). The following mixture was prepared for each sample: 25 μL REDTaq PCR reaction mix (1X), 1 μΕ (20 pmol) of forwarding primer, 1 μL (20 pmol) of reverse primer, 1 μL (200 ng) of genomic DNA, and 22 μL of double-distilled deionized water. This mix was put in a thin-wall PCR microcentrifuge tube and gently centrifuged to collect all components to the bottom of the tube. Then, 50 μL of mineral oil was added to prevent evaporation. Amplification was performed in a Thermal Cycler (TECHEN TC- 312, Model FTC3102D, Barloworld Scientific Ltd., Stone, Staffordshire, st 150 SA,UK) using the following program: initial 5-min denaturation at 94°C followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 45 s, and a final extension for 10 min at 72°C. The resulting PCR product was 206 bp in length. The PCR products were digested using BclI (NewEnglandBiolabs– Catalog #R0160S).

The products were subjected to agarose gel electrophoresis using 2% agarose stained with ethidium bromide and visualized via Light UV Transilluminator (Model TUV-20, OWI Scientific, Inc. 800 242-5560) andphotographed [Figure 2].
Figure 2. Agarose gel electrophoretic analysis of glucocorticoid receptor gene (NR3C1) BclI-polymorphism (rs 41423247): Lane 1 represents the molecular marker (DNA molecular weight marker, purchased from promegaTecnical Service, Catalog#G3161). Lane 2 represents the product of PCR amplification of the gene that is presented by one band at 206 bp. Lane 3 represents the C/Cgenotype is presented showing two bands at 116 and 90bp. Lane 4 represents the C/G genotype showing three bands 206,116 and 90 bp. Lane 5 represents the G/G genotype showing one band at 206 bp. Lane 6 represents negative control.
NR3C1: Nuclear receptor subfamily 3, group C, member 1.


Click here to view


Total cholesterol, triglycerides, and serum levels of albumin estimation were performed using the commercially available kits. Complement C3 was determined by the radial immunodiffusion technique.


   Statistical Analyses Top


In the statistical comparison between the different groups, the significance of difference was tested using one of the analysis of variance [used to compare between more than two groups of numerical (parametric) data], and intergroup comparison of categorical data was performed using Chi-square test (χ2- value).

The Hardy-Weinberg equilibrium (HWE) assumption was assessed for case and control groups by comparing the observed numbers of each genotype with those expected under HWE for the estimated allele frequency. Pearson’s Chi-square (χ2) was used to estimate odds ratios and 95% confidence intervals to gauge the relationship between the genotype and the risk.


   Results Top


The clinical and pathological findings of the patients

The clinicopathological profiles of the patients are summarized in [Table 1]. There was no significant difference between the patient group and control group regarding age and gender [Table 2].
Table 1. The clinicopathological characteristic of the patients with idiopathic nephrotic syndrome (n=100).
SD: Standard deviation, eGFR: estimated glomerular filtration rate, SSNS: Steroid-sensitive NS.


Click here to view
Table 2. Comparison between patients group and control group regarding age and gender.
SD: Standard deviation, P: Probability, �2: Pearson�s Chi-square.


Click here to view


Comparison of the genotype distribution in the patients and the control subjects

The distribution of BclI genotypes was comparable between the patient group (CC 45%, CG 40%, and GG 15%) and in the control group (CC 48%, CG 42%, and GG 10%). The G allele frequencies in both groups were 34.34% versus 31%, and the C allele frequencies in both groups were 65.66% versus 69% [Table 3].
Table 3. Comparison of NR3C1 and nephrin genotype distributions in patients and controls.
The Chi-square (χ2) test was used to evaluate Hardy�Weinberg equilibrium in allele and genotype frequencies in patients and controls. P2: Significance of patients group relative to control group.


Click here to view


The distribution of nephrin genotypes was comparable between the patient group (CC 38%, CT 52%, and TT 10%) and the control group (CC 39%, CT 45%, and TT 16%). The C allele frequencies in both groups were 64% versus 61.5%, and the T allele frequencies in both groups were 72% versus 77% [Table 3].
Table 4. Risk for patients.
SNPs: Single-nucleotide polymorphisms.


Click here to view


The genotype distribution and allele frequencies showed no significant difference between the patient group and the control group. The genotype distribution and allele frequencies showed no significant risk for the patients.

Correlation of genotypes to clinical and pathological features of the patients

The genotype distribution and allele frequencies showed no significant difference between the initial steroid responders and initial steroid nonresponders [Table 5]. The genotype distribution and allele frequencies showed no significant association for initial response to steroids [Table 6].
Table 5. Comparison of NR3C1 and nephrin genotypes in the initial steroid responders and initial steroid nonresponders.
The Chi-square (χ2) test was used to evaluate Hardy�Weinberg equilibrium in allele and genotype frequencies in patients and controls.
P2: Significance of patients with SR group relative to patients with SS group.


Click here to view
Table 6. Risk for patients

Click here to view


The onset age of NS, eGFR, and serum albumin were not affected by any of the genotypes of NR3C1 or nephrin gene. However, 24-h protein in urine showed a significant association with the NR3C1 gene [Table 7].
Table 7. Relation between NR3C1 and nephrin genotypes and the age of onset of nephrotic syndrome, estimated glomerular filtration rate, 24-h protein in urine, and serum albumin.
NS: Nephrotic syndrome, eGFR: estimated glomerular filtration rate.


Click here to view


There was no significant difference in any genotype or allotype distribution between patients with MCNS and patients with FSGS in NR3C1 or nephrin gene [Table 8].
Table 8. Comparison of NR3C1 and nephrin genotypes in the patients with minimal change disease and the patients with focal segmental glomerulosclerosis.
MCD: Minimal change disease, FSGS: Focal segmental glomerulosclerosis, Χ2: Chi-square test.


Click here to view



   Discussion Top


In this study, SNPs of the NR3C1 gene and nephrin gene were genotyped in a group of pediatric patients with idiopathic NS to analyze the correlation between the genotypes and clinicopathologic features of the patients.

Glucocorticoids, the first line of drug for childhood idiopathic NS, exerts its effects by its binding to the GR, a ligand-dependent transcription factor, which belongs to the superfamily of nuclear receptors.[16]

It is well known that the response to glucocorticoid treatment is variable in patients with glomerular diseases including childhood idiopathic NS, asthma, or other common diseases, and the association of NR3C1 polymorphisms and response to glucocorticoid treatment have been analyzed in several studies.[17],[18],[19],[20],[21],[22],[23]

In this study, the BclI genotype distribution in the patient group revealed no difference from that in the control group. Furthermore, BclI genotype showed no significant correlation with the onset age of NS, initial steroid responsiveness, renal pathologic findings, serum albumin, or glomerular filtration rate. However, 24-h protein in urine showed a significant association with the NR3C1 gene.

Koper et al reported that there is a lack of association between five polymorphisms in the human GR gene and glucocorticoid resistance in otherwise healthy persons.[24]

In vitro studies have demonstrated that T cells from patients with glucocorticoid-resistant asthma showed a reversible cytokine-induced reduction in GR binding affinity and an irreversible reduction in GR number.[25] This finding suggests that NR3C1 gene polymorphisms affecting its affinity to glucocorticoids can play an important role in the response to glucocorticoids treatment.

In vitro studies by Russcher et al[26] have demonstrated that two polymorphisms in NR3C1 gene (ER22/23EK and N363S polymorphisms) directly affected glucocorticoid-regulated gene expression, which was confirmed in clinical studies demonstrating that patients with the ER22/23EK allele are relatively more resistant to the effects of glucocorticoids with respect to the sensitivity of the adrenal feedback mechanism than noncarriers, resulting in a better metabolic health profile.[27]

However, the exact influence of these polymorphisms in NR3C1 gene remains to be controversial. Tissing et al[28] demonstrated that these polymorphisms including ER22/23EK, N363S, and BclI are not related to glucocorticoid resistance in childhood acute lymphoblastic leukemia. This finding is compatible with this study. Similarly, several studies of other diseases have shown inconsistent results with each other.[17],[18],[19],[21],[22]

Recently, there have been studies to analyze the association of NR3C1 polymorphisms and response to glucocorticoid treatment in NS. Zalewski et al[17] studied a three-point haplotype (BclI C/G, rs33389 C/T, and rs33388 A/T) within intron B of NR3C1 in 118 children with SSNS and showed that the GTA haplotype was associated with a higher glucocorticoid sensitivity and was found to be more prevalent in early than late prednisone responders. Ye et al found 12 polymorphisms in the GR gene (NR3C1), of which six polymorphisms were identified for the first time. Two types of newly found haplotypes were associated with steroid-resistant idiopathic NS of children, which might be responsible for steroid resistance in partial idiopathic NS of children,[29] but the association between NR3C1 haplotypes and steroid resistance was not significant in Chinese children with sporadic NS.[18]

Cho et al[4] reported that BclI polymorphism in NR3C1 was not associated with the development of NS, response to steroid therapy, renal pathology, or renal outcome in Korean children with idiopathic NS, while among these studies, the distribution of intro B polymorphisms in children in Poland is compatible with that in adults in the United Kingdom.[17],[30] This finding may be speculated that this disagreement observed in the studies is attributable to the difference in ethnics. Although the studies by Ye et al[18] and Cho et al,[4] showed a similar conclusion to this study, the polymorphisms which they found are different from this study; therefore, large-scale clinical studies are necessary to prove the ethical difference in the distribution of NR3C1 polymorphisms and establish the role of NR3C1 polymorphisms.

The nephrin genotype distribution in the patient group revealed no difference from that in the control group. Furthermore, nephrin genotype showed no significant correlation with the onset age of NS, initial steroid responsiveness, renal pathologic findings, proteinuria, serum albumin, or glomerular filtration rate.

There are several studies reporting mutations in NPHS1 gene in congenital FSGS. Koziell et al[31] first reported mutations both in NPHS1 and NPHS2 in four individuals from three different families with congenital FSGS. They found an overlap in the NPHS1/NPHS2 mutation spectrum with the characterization of a unique digenic inheritance of NPHS1 and NPHS2 mutations, which results in a “triallelic” hit and appears to modify the phenotype from CNF to one of the congenital FSGS.[31]

Caridi et al reported one patient with heterozygous NPHS1 mutation and homozygous NPHS2 mutation (R229Q).[32]

Mao et al demonstrate that NPHS1 and NPHS2 mutations are also present in Chinese sporadic NS patients, suggesting that genetic changes of nephrin and podocin may play pathogenetic roles in some patients with sporadic SRNS.[33]

Philippe et al identified that compound heterozygous mutations in the NPHS1 gene were responsible for SRNS in a cohort of patients (between 5 months and 8 years) in whom NPHS2 mutations had been excluded.[34]

Moreover, NPHS1 mutations were described as being the cause of FSGS in adults with SRNS.[35]

The absence of nephrin leads to a distortion of the slit diaphragm, which can be seen in the Finnish CNF patients, who have no slit diaphragm filaments in the electron microscopy.[36] Also, altered expression of nephrin, as studied by light and electron microscopy, has been reported in MCNS.[37],[38],[39] Further, abnormalities in nephrin expression appear to be associated with acquired as well as congenital causes of nephrotic syndrome.[40]

The SNPs of the nephrin gene were associated with diabetes, suggesting that nephrin may play an important role in the pathophysiology of diabetes.[41] However, Pettersson-Fernholm et al results did not support an involvement of the coding region of the nephrin gene in the pathogenesis of diabetic nephropathy in type 1 diabetic patients.[42]

Narita et al suggested a role of the genetic polymorphism of NPHS1, not in the development, but in the clinical manifestations of IgA nephropathy. This investigation has demonstrated that podocyte injury accompanied by downregulation of nephrin is one of the important factors in bringing on irreversible glomerular alterations.

It is possible that an alteration in the expression of nephrin in the pathologic state, which might be associated with the NPHS1 polymorphism, is followed by more severe glomerular injury. However, they could not provide direct evidence for an association between the NPHS1 polymorphism and the expression of nephrin protein in patients with IgA nephropathy.[43]

However, large-scale clinical studies are necessary to prove the ethical difference in the distribution of nephrin polymorphisms and establish the role of nephrin polymorphisms in idiopathic NS in children.


   Conclusion Top


These data suggested that BclI SNPs in the NR3C1 gene and rs#466452 SNP of nephrin gene do not affect the development and the clinical course, initial steroid responsiveness, and renal pathological lesion in Egyptian children with NS. The 24-h protein in urine showed a significant association with NR3C1 gene. Large-scale multicentric clinical studies for a longer duration are necessary to prove or disprove our results.

Conflict of interest: None declared.



 
   References Top

1.
Caridi G, Trivelli A, Sanna-Cherchi S, Perfumo F, Ghiggeri GM. Familial forms of nephrotic syndrome. Pediatr Nephrol 2010;25: 241-52.  Back to cited text no. 1
    
2.
Colquitt JL, Kirby J, Green C, Cooper K, Trompeter RS. The clinical effectiveness and cost-effectiveness of treatments for children with idiopathic steroid-resistant nephrotic syndrome: A systematic review. Health T echnol Assess 2007 ;11 :iii-iv, ix-xi, 1-93.  Back to cited text no. 2
    
3.
Eddy AA, Symons JM. Nephrotic syndrome in childhood. Lancet 2003;362:629-39.  Back to cited text no. 3
    
4.
Cho HY, Choi HJ, Lee SH, et al. Polymorphisms of the NR3C1 gene in Korean children with nephrotic syndrome. Korean J Pediatr 2009;52:1260-6.  Back to cited text no. 4
    
5.
Lôwik MM, Groenen PJ, Levtchenko EN, Monnens LA, vanden Heuvel LP. Molecular genetic analysis of podocyte genes in focal segmental glomerulosclerosis – A review. Eur J Pediatr 2009;168:1291-304.  Back to cited text no. 5
    
6.
Obeidová H, Merta M, Reiterová J, et al. Genetic basis of nephrotic syndrome - Review. Prague Med Rep 2006;107:5-16.  Back to cited text no. 6
    
7.
Gabriel SB, Schaffner SF, Nguyen H, et al. The structure of haplotype blocks in the human genome. Science 2002;296:2225-9.  Back to cited text no. 7
    
8.
Wall JD, Pritchard JK. Haplotype blocks and linkage disequilibrium in the human genome. Nat Rev Genet 2003;4:587-97.  Back to cited text no. 8
    
9.
El-Refaey AM, Bakr A, Hammad A, et al. Primary focal segmental glomerulosclerosis in Egyptian children: A 10-year single-centre experience. Pediatr Nephrol 2010;25:1369-73.  Back to cited text no. 9
    
10.
Gulati S, Kher V, Sharma RK, Gupta A. Steroid response pattern in Indian children with nephrotic syndrome. Acta Paediatr 1994; 83:530-3.  Back to cited text no. 10
    
11.
Update on the 1987 Task Force Report on High Blood Pressure in Children and Adolescents: A working group report from the National High Blood Pressure Education Program. National High Blood Pressure Education Program Working Group on Hypertension Control in Children and Adolescents. Pediatrics 1996;98:649-58.  Back to cited text no. 11
    
12.
Schwartz GJ, Haycock GB, Edelmann CM Jr., Spitzer A. A simple estimate of glomerular filtration rate in children derived from body length and plasma creatinine. Pediatrics 1976; 58:259-63.  Back to cited text no. 12
    
13.
El-Refaey AM, Kapur G, Jain A, et al. Idiopathic collapsing focal segmental glomerulosclerosis in pediatric patients. Pediatr Nephrol 2007;22:396-402.  Back to cited text no. 13
    
14.
González R, Tirado A, Rojas LA, et al. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy. Biol Res 2009;42:189-98.  Back to cited text no. 14
    
15.
Kostik MM, Klyushina AA, Moskalenko MV, Scheplyagina LA, Larionova VI. Glucocorticoid receptor gene polymorphism and juvenile idiopathic arthritis. Pediatr Rheumatol Online J 2011 ;9:2.  Back to cited text no. 15
    
16.
Baxter JD, Rousseau GG. Glucocorticoid hormone action: An overview. Monogr Endocrinol 1979;12:1-24.  Back to cited text no. 16
    
17.
Zalewski G, Wasilewska A, Zoch-Zwierz W, Chyczewski L. Response to prednisone in relation to NR3C1 intron B polymorphisms in childhood nephrotic syndrome. Pediatr Nephrol 2008;23:1073-8.  Back to cited text no. 17
    
18.
Ye J, Yu Z, Ding J, et al. Genetic variations of the NR3C1 gene in children with sporadic nephrotic syndrome. Biochem Biophys Res Commun 2006;348:507-13.  Back to cited text no. 18
    
19.
Kuningas M, Mooijaart SP, Slagboom PE, Westendorp RG, vanHeemst D. Genetic variants in the glucocorticoid receptor gene (NR3C1) and cardiovascular disease risk. The Leiden 85-plus Study. Biogerontology 2006;7:231-8.  Back to cited text no. 19
    
20.
Cercato C, Halpern A, Frazzatto ES, Guazzelli IC, Villares SM. The N363S polymorphism in the glucocorticoid receptor gene: Effects on visceral fat assessed by abdominal computed tomography. Arq Bras Endocrinol Metabol 2009;53:288-92.  Back to cited text no. 20
    
21.
Roussel R, Reis AF, Dubois-Laforgue D, Bellanné-Chantelot C, Timsit J, Velho G. The N363S polymorphism in the glucocorticoid receptor gene is associated with overweight in subjects with type 2 diabetes mellitus. Clin Endocrinol (Oxf) 2003;59:237-41.  Back to cited text no. 21
    
22.
.Lin RC, Wang XL, Morris BJ. Association of coronary artery disease with glucocorticoid receptor N363S variant. Hypertension 2003; 41:404-7.  Back to cited text no. 22
    
23.
Donn R, Payne D, Ray D. Glucocorticoid receptor gene polymorphisms and susceptibility to rheumatoid arthritis. Clin Endocrinol (Oxf) 2007;67:342-5.  Back to cited text no. 23
    
24.
Koper JW, Stolk RP, deLange P, et al. Lack of association between five polymorphisms in the human glucocorticoid receptor gene and glucocorticoid resistance. Hum Genet 1997; 99:663-8.  Back to cited text no. 24
    
25.
Sher ER, Leung DY, Surs W,et al. Steroid-resistant asthma. Cellular mechanisms contributing to inadequate response to glucocorticoid therapy. J Clin Invest 1994; 93:33-9.  Back to cited text no. 25
    
26.
Russcher H, Smit P, vanden Akker EL, et al. Two polymorphisms in the glucocorticoid receptor gene directly affect glucocorticoid-regulated gene expression. J Clin Endocrinol Metab 2005;90:5804-10.  Back to cited text no. 26
    
27.
van Rossum EF, Koper JW, Huizenga NA, et al. A polymorphism in the glucocorticoid receptor gene, which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels. Diabetes 2002; 51:3128-34.  Back to cited text no. 27
    
28.
Tissing WJ, Meijerink JP, denBoer ML, et al. Genetic variations in the glucocorticoid receptor gene are not related to glucocorticoid resistance in childhood acute lymphoblastic leukemia. Clin Cancer Res 2005;11:6050-6.  Back to cited text no. 28
    
29.
Ye JW, Ding J, Huang JP, et al.Analysis on association of glucocorticoid receptor gene polymorphism with steroid-resistance in idiopathic nephrotic syndrome of children. Zhonghua ErKe ZaZhi 2003;41:661-5.  Back to cited text no. 29
    
30.
Stevens A, Ray DW, Zeggini E, et al. Glucocorticoid sensitivity is determined by a specific glucocorticoid receptor haplotype.J Clin Endocrinol Metab 2004;89:892-7.  Back to cited text no. 30
    
31.
Koziell A, Grech V, Hussain S, et al. Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome advocate a functional inter-relationship in glomerular filtration. Hum Mol Genet 2002; 11:379-88.  Back to cited text no. 31
    
32.
Caridi G, Bertelli R, Carrea A, et al. Prevalence, genetics, and clinical features of patients carrying podocin mutations in steroid-resistant nonfamilial focal segmental glomerulosclerosis. J Am Soc Nephrol 2001;12: 2742-6.  Back to cited text no. 32
    
33.
Mao J, Zhang Y, Du L, et al. NPHS1 and NPHS2 gene mutations in Chinese children with sporadic nephrotic syndrome. Pediatr Res 2007;61:117-22.  Back to cited text no. 33
    
34.
Philippe A, Nevo F, Esquivel EL, et al. Nephrin mutations can cause childhood-onset steroid-resistant nephrotic syndrome. J Am Soc Nephrol 2008;19:1871-8.  Back to cited text no. 34
    
35.
Santín S, García-Maset R, Ruíz P, et al. Nephrin mutations cause childhood- and adult- onset focal segmental glomerulosclerosis. Kidney Int 2009;76:1268-76.  Back to cited text no. 35
    
36.
Patrakka J, Kestila M, Wartiovaara J, et al. Congenital nephrotic syndrome (NPHS1): Features resulting from different mutations in Finnish patients. Kidney Int 2000;58:972-80.  Back to cited text no. 36
    
37.
Wernerson A, Dunér F, Pettersson E, et al. Altered ultrastructural distribution of nephrin in minimal change nephrotic syndrome. Nephrol Dial Transplant 2003;18:70-6.  Back to cited text no. 37
    
38.
DoublierS, Ruotsalainen V, Salvidio G, et al. Nephrin redistribution on podocytes is a potential mechanism for proteinuria in patients with primary acquired nephrotic syndrome. Am J Pathol 2001;158:1723-31.  Back to cited text no. 38
    
39.
Lahdenkari AT, Kestila M, Holmberg C, Koskimies O, Jalanko H. Nephrin gene (NPHS1) in patients with minimal change nephrotic syndrome (MCNS). Kidney Int 2004;65:1856-63.  Back to cited text no. 39
    
40.
Furness PN, Hall LL, Shaw JA, Pringle JH. Glomerular expression of nephrin is decreased in acquired human nephrotic syndrome. Nephrol Dial Transplant 1999;14:1234-7.  Back to cited text no. 40
    
41.
Daimon M, Ji G, Oizumi T, et al. Association of nephrin gene polymorphisms with type 2 diabetes in a Japanese population: The Funagata study. Diabetes Care 2006;29:1117- 9.  Back to cited text no. 41
    
42.
Pettersson-Fernholm K, Forsblom C, Perola M, Groop PH, Finn Diane Study Group. Polymorphisms in the nephrin gene and diabetic nephropathy in type 1 diabetic patients. Kidney Int 2003;63:1205-10.  Back to cited text no. 42
    
43.
Narita I, Goto S, Saito N, et al. Genetic polymorphism of NPHS1 modifies the clinical manifestations of Ig A nephropathy. Lab Invest 2003;83:1193-200.  Back to cited text no. 43
    

Top
Correspondence Address:
Ahmed M. El-Refaey
Pediatric Nephrology Unit, Mansoura University Children’s Hospital, Mansoura University, Mansoura, Egypt.
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1319-2442.352422

Rights and Permissions


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6], [Table 7], [Table 8]



 

Top
   
 
 
    Similar in PUBMED
    Search Pubmed for
    Search in Google Scholar for
    Email Alert *
    Add to My List *
* Registration required (free)  
 


 
    Abstract
   Introduction
    Materials and Me...
   Statistical Analyses
   Results
   Discussion
   Conclusion
    References
    Article Figures
    Article Tables
 

 Article Access Statistics
    Viewed324    
    Printed6    
    Emailed0    
    PDF Downloaded31    
    Comments [Add]    

Recommend this journal